Mr Jefferson

Ask me anythingP√°gina siguienteArchivo

Primer dia de @dreambeachfest DONE! Vaya locura con Mangel jajaja Zombies… Cabezas de caballo, demacre… Noshh tou boorrachoouuu!!!! DROOOOOOOOOOOOOOOOP!!! Put ya fuckin hands in the air!! Tatatatatatatatatrarararraratatatatttatatatattataannnnnnn (silencio) tiiiiiatayatatatttttitiitititittttaatatatagaggagatatatata pumpumpum (silencio corto) tiriririririri (Jump, jump, jump) DROP. Tararararatatararatgagagagagaggfaffa ytititititititititititigūüéČ #bear #party#music#dreambeach #govillaricos #crazy #madness #festival#new#friends#amigos (en San Juan de los Terreros)
Out now in @beatport @avenuerecordings !! SAME SHET EP!! :) Come on and grab your copy!! #new #music #techno #techhouse
Amazing night with @hectorcouto at @tuaregclub !!!!! @happy_records #aguilasisdiferent #house #deep #tech #crazy #night #party #club  (en Tuareg)
Cena saludable…


Beautiful drunk people!ūüéČ #drunk #party #omg #instacarnival #instagood #instaparty #instayomeloguisoyomelocomo #beautiful #aguilas #carnaval
Jamie Jones mode! #carnival #music #techhouse #deep #house #party #costume #hotcreations

Deep Inside Chart - Jan 18, 2014 by Partygroove Station on Mixcloud

Just favorited Deep Inside Chart - Jan 18, 2014 by PartyGroove Station on Mixcloud

CAAANT WAIT! For our new label! #black #kuda #picoftheday #music #tech #deep @Happy_Records @LorcaElectro (en Happy Labs, YOUR MIND!)